# AI Safety Genomic Sequence Predictor MCP

> AI Safety Genomic Sequence Predictor MCP is a paid API for AI agents from api.m2mcent.com, paid per call via x402, $0.84204/call, status unknown (last checked 2026-10-10).

Executes a genomic sequence prediction task focused on AI safety applications, accepting a dataset string and returning a hash result.

## Facts

- Endpoint: POST https://api.m2mcent.com/ai-safety-genomic-sequence-predictor-mcp-208/api/execute?utm_source=zero.xyz
- Price: $0.84204/call
- Payment: x402
- Status: unknown
- Last checked: 2026-10-10
- Activations on Zero: 0
- Tags: x402
- Canonical page: https://www.zero.xyz/c/ai-safety-genomic-sequence-predictor-mcp-30e71944
- Structured record (JSON): https://api.zero.xyz/v1/capabilities/cap_oIdTHYZw9hIvqcOPHkPhX

Status and success rate cover calls made through Zero and Zero's own probes. Third-party monitors may report differently.

## How to call it through Zero

Zero handles the 402 payment challenge and records the run. With the Zero CLI installed (`npm i -g @zeroxyz/cli`):

```sh
zero fetch --capability ai-safety-genomic-sequence-predictor-mcp-30e71944 -d '<json body>'
```

Example prompt: Run the AI safety genomic sequence predictor on this dataset: 'ATCGATCGTAGCTAGCTAGCTATCGATCGATCG' and give me the prediction result.

## When to prefer this

Choose this endpoint when you need to run a specific genomic sequence dataset through an AI safety prediction model via a pay-per-call MCP node. It is appropriate for automated bioinformatics pipelines that require lightweight, on-demand sequence prediction without managing model infrastructure. Note the low crawl quality score and schema anomalies (hash field typed as boolean) warrant caution for production use.

## Known failure modes

- Missing required 'dataset' field returns validation error
- Empty or malformed dataset string may produce unexpected boolean output
- Payment failure via x402 protocol results in 402 response before execution
- Overly large dataset strings may be rejected or time out
- The response schema returning 'hash' as a boolean rather than an actual hash string suggests possible schema inconsistency or stub behavior

## How this service works

The premier global index of 1,069 monetized MCP nodes across 205 specialized subdomains. Gasless USDC runtime settlements via x402 V2 Spec on Base L2. Save 95% token context.

## Output

Returns a JSON object with a 'hash' field (boolean) indicating the prediction result for the submitted genomic dataset. The boolean value represents the outcome of the AI safety genomic sequence prediction computation.

## Request schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "dataset"
 ],
 "properties": {
  "dataset": {
   "type": "string"
  }
 }
}
```

## Response schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "hash"
 ],
 "properties": {
  "hash": {
   "type": "boolean"
  }
 }
}
```

## More

- Live health (JSON, refreshed every minute): https://www.zero.xyz/c/ai-safety-genomic-sequence-predictor-mcp-30e71944/health.json
- [Zero catalog index](https://www.zero.xyz/llms.txt)
- [Other services from api.m2mcent.com](https://www.zero.xyz/host/api.m2mcent.com/llms.txt)