# AI Safety Genomic Sequence Synthesizer MCP

> AI Safety Genomic Sequence Synthesizer MCP is a paid API for AI agents from api.m2mcent.com, paid per call via x402, $0.386408/call, status unknown (last checked 2026-10-21).

Accepts a genomic sequence payload and returns a binary prediction indicating AI safety classification for that sequence.

## Facts

- Endpoint: POST https://api.m2mcent.com/ai-safety-genomic-sequence-synthesizer-mcp-515/api/execute?utm_source=zero.xyz
- Price: $0.386408/call
- Payment: x402
- Status: unknown
- Last checked: 2026-10-21
- Activations on Zero: 0
- Tags: x402
- Canonical page: https://www.zero.xyz/c/ai-safety-genomic-sequence-synthesizer-mcp-272d638e
- Structured record (JSON): https://api.zero.xyz/v1/capabilities/cap_6G0HiYe_2eQw5l1ROSUwG

Status and success rate cover calls made through Zero and Zero's own probes. Third-party monitors may report differently.

## How to call it through Zero

Zero handles the 402 payment challenge and records the run. With the Zero CLI installed (`npm i -g @zeroxyz/cli`):

```sh
zero fetch --capability ai-safety-genomic-sequence-synthesizer-mcp-272d638e -d '<json body>'
```

Example prompt: Run a biosafety prediction on this genomic sequence payload and tell me whether it passes the AI safety check: 'ATCGGCTAGCTAGCTAGCTAGCTAGCTAGCGCATGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA'.

## When to prefer this

Use this endpoint when you need a fast, automated binary safety classification for a raw genomic sequence string within a biosecurity or synthetic biology workflow. It is well-suited for programmatic pipelines that require a pass/fail gate before proceeding with DNA synthesis or distribution. Prefer this over general-purpose LLM analysis when you need a deterministic, low-latency boolean result rather than an open-ended explanation.

## Known failure modes

- Missing required 'payload' field returns a validation error
- Malformed or non-string payload may cause a 400 bad request
- Payment failure via x402 protocol (insufficient USDC balance) results in a 402 Payment Required response
- Oversized payloads may be rejected with a 413 or timeout
- Ambiguous or non-genomic string inputs may produce unreliable boolean predictions
- Network or node unavailability returns 503 or connection timeout

## How this service works

The premier global index of 1,069 monetized MCP nodes across 205 specialized subdomains. Gasless USDC runtime settlements via x402 V2 Spec on Base L2. Save 95% token context.

## Output

Returns a JSON object with a single boolean field 'prediction' — true or false — indicating whether the submitted genomic sequence payload passes the AI safety classification check.

## Request schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "payload"
 ],
 "properties": {
  "payload": {
   "type": "string"
  }
 }
}
```

## Response schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "prediction"
 ],
 "properties": {
  "prediction": {
   "type": "boolean"
  }
 }
}
```

## More

- Live health (JSON, refreshed every minute): https://www.zero.xyz/c/ai-safety-genomic-sequence-synthesizer-mcp-272d638e/health.json
- [Zero catalog index](https://www.zero.xyz/llms.txt)
- [Other services from api.m2mcent.com](https://www.zero.xyz/host/api.m2mcent.com/llms.txt)