# CRISPR-Cas9 Off-Target Site Predictor

> CRISPR-Cas9 Off-Target Site Predictor is a paid API for AI agents from api.m2mcent.com, paid per call via x402, $0.3/call, status unknown (last checked 2026-10-16).

Predicts and analyzes potential off-target cleavage sites for CRISPR-Cas9 guide RNA sequences

## Facts

- Endpoint: POST https://api.m2mcent.com/crispr-cas9-offtarget-mcp/api/process?utm_source=zero.xyz
- Price: $0.3/call
- Payment: x402
- Status: unknown
- Last checked: 2026-10-16
- Activations on Zero: 0
- Tags: x402
- Canonical page: https://www.zero.xyz/c/crispr-cas9-off-target-site-predictor-2cd3e98d
- Structured record (JSON): https://api.zero.xyz/v1/capabilities/cap_jRJ27aqxDXUekgcVEGn1D

Status and success rate cover calls made through Zero and Zero's own probes. Third-party monitors may report differently.

## How to call it through Zero

Zero handles the 402 payment challenge and records the run. With the Zero CLI installed (`npm i -g @zeroxyz/cli`):

```sh
zero fetch --capability crispr-cas9-off-target-site-predictor-2cd3e98d -d '<json body>'
```

Example prompt: Can you analyze this CRISPR-Cas9 guide RNA sequence — GCACTGAGCTAGCTAGCTAT — and identify any potential off-target cleavage sites in the human genome, including their risk scores and mismatch profiles?

## When to prefer this

Use this endpoint when you need computational prediction of CRISPR-Cas9 off-target cleavage sites before conducting wet-lab experiments, particularly when evaluating guide RNA specificity for therapeutic, research, or agricultural gene-editing applications. It is especially valuable as a pre-screening step to rank and filter guide RNA candidates by off-target risk without requiring genome-wide sequencing.

## Known failure modes

- Invalid or malformed guide RNA sequence returns an error or empty result
- Sequence too short or too long for the model's supported input range
- Ambiguous nucleotide characters in the input may cause processing failure
- Non-DNA characters in the data field cause rejection
- Service may time out for very large genomic queries

## How this service works

The premier global index of 1,069 monetized MCP nodes across 205 specialized subdomains. Gasless USDC runtime settlements via x402 V2 Spec on Base L2. Save 95% token context.

## Output

Returns a list of predicted off-target genomic sites for the submitted guide RNA, including chromosomal coordinates, mismatch counts and positions, Cas9 cleavage likelihood scores, and an overall specificity or risk assessment to help evaluate guide RNA safety before experimental use.

## Response schema (JSON Schema)

```json
{
 "type": "json",
 "example": {
  "success": true
 }
}
```

## More

- Live health (JSON, refreshed every minute): https://www.zero.xyz/c/crispr-cas9-off-target-site-predictor-2cd3e98d/health.json
- [Zero catalog index](https://www.zero.xyz/llms.txt)
- [Other services from api.m2mcent.com](https://www.zero.xyz/host/api.m2mcent.com/llms.txt)