# CRISPR Off-Target Similarity Scorer

> CRISPR Off-Target Similarity Scorer is a paid API for AI agents from bio.halowerk.com, paid per call via x402, $0.004/call, status unknown (last checked 2026-09-14).

Ranks user-supplied candidate protospacers against a guide RNA sequence using a mismatch-weighted similarity score with NGG PAM penalty, emphasizing the guide's seed region (final 10 positions).

## Facts

- Endpoint: POST https://bio.halowerk.com/v1/crispr-offtarget
- Price: $0.004/call
- Payment: x402
- Status: unknown
- Last checked: 2026-09-14
- Activations on Zero: 0
- Tags: x402
- Canonical page: https://www.zero.xyz/c/crispr-off-target-similarity-scorer-ad357447
- Structured record (JSON): https://api.zero.xyz/v1/capabilities/cap_QdgxYIc9rTxgqBYJEPggj

Status and success rate cover calls made through Zero and Zero's own probes. Third-party monitors may report differently.

## How to call it through Zero

Zero handles the 402 payment challenge and records the run. With the Zero CLI installed (`npm i -g @zeroxyz/cli`):

```sh
zero fetch --capability crispr-off-target-similarity-scorer-ad357447 -d '<json body>'
```

Example prompt: Score these 5 candidate protospacers against my guide RNA sequence ACGTACGTACGTACGTACGT for off-target similarity — their IDs are C1 through C5 with protospacers and NGG PAMs as listed — and rank them by how likely they are to be off-target sites based on seed-region mismatches.

## When to prefer this

Use this endpoint when you need a fast, transparent, rule-based off-target similarity ranking for a batch of candidate protospacers without requiring genome access or complex biological modeling. Prefer this over full off-target prediction tools (e.g. Cas-OFFinder, CRISPOR) when you already have candidate sequences from upstream alignment and need a lightweight, auditable score weighted by seed-region biology. Not suitable for clinical or laboratory safety decisions.

## Known failure modes

- Invalid DNA characters in guide or protospacer (non-ACGT) returns validation error
- Guide sequence shorter than 17 or longer than 30 nt rejected
- Candidate array exceeds 1000 items returns limit error
- PAM shorter than 2 or longer than 8 nt rejected
- Missing required fields (id, protospacer, pam) per candidate returns schema error
- Mismatched protospacer length vs guide may affect score interpretation

## How this service works

Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.

## Output

Returns a ranked list of candidate protospacers with a transparency similarity score for each, factoring in double-weighted mismatches in the guide's final 10 positions (seed region) and an NGG PAM penalty. Does not perform genome search, model bulges, chromatin accessibility, or nuclease-specific biology.

## Request schema (JSON Schema)

```json
{
 "type": "object",
 "properties": {
  "guide": {
   "type": "string",
   "pattern": "^[ACGT]+$",
   "maxLength": 30,
   "minLength": 17,
   "description": "Guide sequence written 5-prime to 3-prime."
  },
  "candidates": {
   "type": "array",
   "items": {
    "type": "object",
    "required": [
     "id",
     "protospacer",
     "pam"
    ],
    "properties": {
     "id": {
      "type": "string",
      "maxLength": 128,
      "minLength": 1
     },
     "pam": {
      "type": "string",
      "pattern": "^[ACGT]+$",
      "maxLength": 8,
      "minLength": 2
     },
     "protospacer": {
      "type": "string",
      "pattern": "^[ACGT]+$",
      "maxLength": 30,
      "minLength": 17
     }
    },
    "additionalProperties": false
   },
   "maxItems": 1000,
   "minItems": 1
  }
 }
}
```

## More

- Live health (JSON, refreshed every minute): https://www.zero.xyz/c/crispr-off-target-similarity-scorer-ad357447/health.json
- [Zero catalog index](https://www.zero.xyz/llms.txt)
- [Other services from bio.halowerk.com](https://www.zero.xyz/host/bio.halowerk.com/llms.txt)