# DeFi Genomic Sequence Simulator MCP

> DeFi Genomic Sequence Simulator MCP is a paid API for AI agents from api.m2mcent.com, paid per call via x402, $0.01275/call, status unknown (last checked 2026-10-10).

Simulates genomic sequences in a DeFi-native MCP node context, returning a summary boolean result via a monetized remote execution endpoint.

## Facts

- Endpoint: POST https://api.m2mcent.com/defi-genomic-sequence-simulator-mcp-823/api/execute?utm_source=zero.xyz
- Price: $0.01275/call
- Payment: x402
- Status: unknown
- Last checked: 2026-10-10
- Activations on Zero: 0
- Tags: x402
- Canonical page: https://www.zero.xyz/c/defi-genomic-sequence-simulator-mcp-5e15a89e
- Structured record (JSON): https://api.zero.xyz/v1/capabilities/cap_4P9D7B18IIqPg2hDp39Zp

Status and success rate cover calls made through Zero and Zero's own probes. Third-party monitors may report differently.

## How to call it through Zero

Zero handles the 402 payment challenge and records the run. With the Zero CLI installed (`npm i -g @zeroxyz/cli`):

```sh
zero fetch --capability defi-genomic-sequence-simulator-mcp-5e15a89e -d '<json body>'
```

Example prompt: Run a genomic sequence simulation with this input data string and give me back the summary result: 'ATCGGCTATCGATCGGCTATCG'.

## When to prefer this

Choose this endpoint when you need to execute a genomic sequence simulation via a monetized remote MCP node and only need a boolean summary output; suitable for automated pipelines that pay per-call via USDC on Base L2.

## Known failure modes

- Missing required 'data' field returns a validation error
- Malformed or non-string data input may cause a processing failure
- Payment failure via x402 protocol prevents execution
- Network timeout on the remote MCP node
- Invalid genomic data format may yield an ambiguous boolean result

## How this service works

The premier global index of 1,069 monetized MCP nodes across 205 specialized subdomains. Gasless USDC runtime settlements via x402 V2 Spec on Base L2. Save 95% token context.

## Output

Returns a JSON object with a 'summary' boolean field indicating whether the genomic sequence simulation passed or produced a positive result.

## Request schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "data"
 ],
 "properties": {
  "data": {
   "type": "string"
  }
 }
}
```

## Response schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "summary"
 ],
 "properties": {
  "summary": {
   "type": "boolean"
  }
 }
}
```

## More

- Live health (JSON, refreshed every minute): https://www.zero.xyz/c/defi-genomic-sequence-simulator-mcp-5e15a89e/health.json
- [Zero catalog index](https://www.zero.xyz/llms.txt)
- [Other services from api.m2mcent.com](https://www.zero.xyz/host/api.m2mcent.com/llms.txt)