# IoT Genomic Sequence Aggregator MCP

> IoT Genomic Sequence Aggregator MCP is a paid API for AI agents from api.m2mcent.com, paid per call via x402, $0.847722/call, status unknown (last checked 2026-10-13).

Accepts a text input and returns a boolean score, ostensibly aggregating or evaluating IoT genomic sequence data via an MCP node.

## Facts

- Endpoint: POST https://api.m2mcent.com/iot-genomic-sequence-aggregator-mcp-319/api/execute?utm_source=zero.xyz
- Price: $0.847722/call
- Payment: x402
- Status: unknown
- Last checked: 2026-10-13
- Activations on Zero: 0
- Tags: x402
- Canonical page: https://www.zero.xyz/c/iot-genomic-sequence-aggregator-mcp-e2b1b7a6
- Structured record (JSON): https://api.zero.xyz/v1/capabilities/cap_NQTSiUGLWSM9B2FWhW6af

Status and success rate cover calls made through Zero and Zero's own probes. Third-party monitors may report differently.

## How to call it through Zero

Zero handles the 402 payment challenge and records the run. With the Zero CLI installed (`npm i -g @zeroxyz/cli`):

```sh
zero fetch --capability iot-genomic-sequence-aggregator-mcp-e2b1b7a6 -d '<json body>'
```

Example prompt: Can you run this genomic sequence text through the IoT Genomic Sequence Aggregator and tell me if it scores true or false: 'ATCGGCTAGCTAGCTAGCTA'?

## When to prefer this

Use this endpoint when you need to run a text-based genomic sequence through an IoT-oriented aggregation pipeline and require a simple boolean pass/fail result. Suitable for automated triage workflows where a binary outcome suffices.

## Known failure modes

- Missing required 'text' field returns validation error
- Empty string input may return unexpected boolean result
- Non-genomic text input may produce unreliable boolean score
- Payment failure via x402 protocol results in 402 status and no response body
- Malformed JSON body returns 400 error

## How this service works

The premier global index of 1,069 monetized MCP nodes across 205 specialized subdomains. Gasless USDC runtime settlements via x402 V2 Spec on Base L2. Save 95% token context.

## Output

A JSON object containing a single 'score' field with a boolean value (true or false), indicating the result of the genomic sequence aggregation or evaluation.

## Request schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "text"
 ],
 "properties": {
  "text": {
   "type": "string"
  }
 }
}
```

## Response schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "score"
 ],
 "properties": {
  "score": {
   "type": "boolean"
  }
 }
}
```

## More

- Live health (JSON, refreshed every minute): https://www.zero.xyz/c/iot-genomic-sequence-aggregator-mcp-e2b1b7a6/health.json
- [Zero catalog index](https://www.zero.xyz/llms.txt)
- [Other services from api.m2mcent.com](https://www.zero.xyz/host/api.m2mcent.com/llms.txt)