# LegalTech Genomic Sequence Validator MCP

> LegalTech Genomic Sequence Validator MCP is a paid API for AI agents from api.m2mcent.com, paid per call via x402, $0.061838/call, status unknown (last checked 2026-10-10).

Validates genomic sequences in the context of legal and regulatory compliance use cases via a prompt-driven MCP node.

## Facts

- Endpoint: POST https://api.m2mcent.com/legaltech-genomic-sequence-validator-mcp-677/api/execute?utm_source=zero.xyz
- Price: $0.061838/call
- Payment: x402
- Status: unknown
- Last checked: 2026-10-10
- Activations on Zero: 0
- Tags: x402
- Canonical page: https://www.zero.xyz/c/legaltech-genomic-sequence-validator-mcp-96ba3372
- Structured record (JSON): https://api.zero.xyz/v1/capabilities/cap_x-9hSyT0Lzhf_rc4LmgGj

Status and success rate cover calls made through Zero and Zero's own probes. Third-party monitors may report differently.

## How to call it through Zero

Zero handles the 402 payment challenge and records the run. With the Zero CLI installed (`npm i -g @zeroxyz/cli`):

```sh
zero fetch --capability legaltech-genomic-sequence-validator-mcp-96ba3372 -d '<json body>'
```

Example prompt: Can you validate this genomic sequence for legal compliance — the sequence is 'ATCGGCTAGCTAGCTAGCTA' — and let me know if it passes?

## When to prefer this

Use this endpoint when you need a quick boolean pass/fail validation of a genomic sequence against legal or regulatory criteria and are operating in an x402 micropayment environment. Best suited for legaltech pipelines that need lightweight, low-cost genomic data compliance checks without integrating a full bioinformatics platform.

## Known failure modes

- Missing 'prompt' field returns a 400 validation error
- Malformed or empty genomic sequence may return false without explanation
- Payment failure via x402 protocol returns HTTP 402 before processing
- Ambiguous prompt may yield inconsistent boolean results
- No detailed error message explaining why validation failed

## How this service works

The premier global index of 1,069 monetized MCP nodes across 205 specialized subdomains. Gasless USDC runtime settlements via x402 V2 Spec on Base L2. Save 95% token context.

## Output

Returns a JSON object with a boolean 'analysis' field indicating whether the provided genomic sequence prompt passes the legal/regulatory validation check (true = valid, false = invalid).

## Request schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "prompt"
 ],
 "properties": {
  "prompt": {
   "type": "string"
  }
 }
}
```

## Response schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "analysis"
 ],
 "properties": {
  "analysis": {
   "type": "boolean"
  }
 }
}
```

## More

- Live health (JSON, refreshed every minute): https://www.zero.xyz/c/legaltech-genomic-sequence-validator-mcp-96ba3372/health.json
- [Zero catalog index](https://www.zero.xyz/llms.txt)
- [Other services from api.m2mcent.com](https://www.zero.xyz/host/api.m2mcent.com/llms.txt)