# M2MCent Healthcare Genomic Sequence Predictor MCP

> M2MCent Healthcare Genomic Sequence Predictor MCP is a paid API for AI agents from api.m2mcent.com, paid per call via x402, $1.396484/call, status unknown (last checked 2026-10-10).

Executes a genomic sequence prediction task via a monetized MCP node, returning a hash-validated result over the x402 payment protocol.

## Facts

- Endpoint: POST https://api.m2mcent.com/healthcare-genomic-sequence-predictor-mcp-621/api/execute?utm_source=zero.xyz
- Price: $1.396484/call
- Payment: x402
- Status: unknown
- Last checked: 2026-10-10
- Activations on Zero: 0
- Tags: x402
- Canonical page: https://www.zero.xyz/c/m2mcent-healthcare-genomic-sequence-predictor-mcp-45faab3a
- Structured record (JSON): https://api.zero.xyz/v1/capabilities/cap_kzFa15hUx83im-1LjdXzc

Status and success rate cover calls made through Zero and Zero's own probes. Third-party monitors may report differently.

## How to call it through Zero

Zero handles the 402 payment challenge and records the run. With the Zero CLI installed (`npm i -g @zeroxyz/cli`):

```sh
zero fetch --capability m2mcent-healthcare-genomic-sequence-predictor-mcp-45faab3a -d '<json body>'
```

Example prompt: Run the healthcare genomic sequence predictor on this DNA sequence string: 'ATCGGCTAAGCTTACGGATCCA' and give me the prediction result.

## When to prefer this

Choose this endpoint when you need to execute a genomic sequence prediction task via a pay-per-call MCP node with gasless USDC settlement on Base L2. Suitable for automated bioinformatics pipelines where per-call micropayment is acceptable and a simple boolean prediction result suffices.

## Known failure modes

- Missing or empty payload field returns validation error
- Malformed genomic sequence string may yield incorrect prediction
- Payment failure via x402 protocol causes 402 response before execution
- Timeout if sequence payload is excessively large
- Boolean hash output provides limited interpretability without additional context

## How this service works

The premier global index of 1,069 monetized MCP nodes across 205 specialized subdomains. Gasless USDC runtime settlements via x402 V2 Spec on Base L2. Save 95% token context.

## Output

Returns a JSON object with a 'hash' field (boolean) indicating the outcome of the genomic prediction computation. The boolean hash represents a validated prediction result for the submitted sequence payload.

## Request schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "payload"
 ],
 "properties": {
  "payload": {
   "type": "string"
  }
 }
}
```

## Response schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "hash"
 ],
 "properties": {
  "hash": {
   "type": "boolean"
  }
 }
}
```

## More

- Live health (JSON, refreshed every minute): https://www.zero.xyz/c/m2mcent-healthcare-genomic-sequence-predictor-mcp-45faab3a/health.json
- [Zero catalog index](https://www.zero.xyz/llms.txt)
- [Other services from api.m2mcent.com](https://www.zero.xyz/host/api.m2mcent.com/llms.txt)