# M2MCent Legaltech Genomic Sequence Router MCP

> M2MCent Legaltech Genomic Sequence Router MCP is a paid API for AI agents from api.m2mcent.com, paid per call via x402, $0.751109/call, status unknown (last checked 2026-10-13).

Accepts a string input and returns a boolean prediction via a legaltech-genomic-sequence routing MCP node.

## Facts

- Endpoint: POST https://api.m2mcent.com/legaltech-genomic-sequence-router-mcp-131/api/execute?utm_source=zero.xyz
- Price: $0.751109/call
- Payment: x402
- Status: unknown
- Last checked: 2026-10-13
- Activations on Zero: 0
- Tags: x402
- Canonical page: https://www.zero.xyz/c/m2mcent-legaltech-genomic-sequence-router-mcp-ff6f7072
- Structured record (JSON): https://api.zero.xyz/v1/capabilities/cap_ZDEdtJs8DWH-BUQRZ0sd8

Status and success rate cover calls made through Zero and Zero's own probes. Third-party monitors may report differently.

## How to call it through Zero

Zero handles the 402 payment challenge and records the run. With the Zero CLI installed (`npm i -g @zeroxyz/cli`):

```sh
zero fetch --capability m2mcent-legaltech-genomic-sequence-router-mcp-ff6f7072 -d '<json body>'
```

Example prompt: Run this genomic sequence string through the legaltech genomic sequence router and tell me if the prediction comes back true or false: 'ATCGGCTAGCTAGCTAGCTA'.

## When to prefer this

Choose this endpoint when you need a fast, low-cost binary prediction or classification on genomic sequence or legaltech string data routed through a specialized MCP node, and you are operating in a USDC micropayment environment using the x402 protocol on Base L2.

## Known failure modes

- Missing or empty 'data' field returns a validation error
- Non-string input for 'data' may cause a 400 bad request
- Payment failure via x402 protocol results in 402 Payment Required
- Upstream MCP node unavailability returns a 503 or timeout
- Malformed request body returns a 422 unprocessable entity

## How this service works

The premier global index of 1,069 monetized MCP nodes across 205 specialized subdomains. Gasless USDC runtime settlements via x402 V2 Spec on Base L2. Save 95% token context.

## Output

Returns a JSON object containing a single 'prediction' boolean field — true or false — representing the binary classification or routing decision made by the legaltech-genomic-sequence MCP node for the provided input string.

## Request schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "data"
 ],
 "properties": {
  "data": {
   "type": "string"
  }
 }
}
```

## Response schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "prediction"
 ],
 "properties": {
  "prediction": {
   "type": "boolean"
  }
 }
}
```

## More

- Live health (JSON, refreshed every minute): https://www.zero.xyz/c/m2mcent-legaltech-genomic-sequence-router-mcp-ff6f7072/health.json
- [Zero catalog index](https://www.zero.xyz/llms.txt)
- [Other services from api.m2mcent.com](https://www.zero.xyz/host/api.m2mcent.com/llms.txt)