# Supply Chain Genomic Sequence Analyzer MCP

> Supply Chain Genomic Sequence Analyzer MCP is a paid API for AI agents from api.m2mcent.com, paid per call via x402, $1.090386/call, status unknown (last checked 2026-10-21).

Analyzes genomic sequence data in the context of supply chain operations, returning a summary result via a monetized MCP node.

## Facts

- Endpoint: POST https://api.m2mcent.com/supply-chain-genomic-sequence-analyzer-mcp-372/api/execute?utm_source=zero.xyz
- Price: $1.090386/call
- Payment: x402
- Status: unknown
- Last checked: 2026-10-21
- Activations on Zero: 0
- Tags: x402
- Canonical page: https://www.zero.xyz/c/supply-chain-genomic-sequence-analyzer-mcp-348b5a61
- Structured record (JSON): https://api.zero.xyz/v1/capabilities/cap_HPLPfRu-8WrTQYkccfm0S

Status and success rate cover calls made through Zero and Zero's own probes. Third-party monitors may report differently.

## How to call it through Zero

Zero handles the 402 payment challenge and records the run. With the Zero CLI installed (`npm i -g @zeroxyz/cli`):

```sh
zero fetch --capability supply-chain-genomic-sequence-analyzer-mcp-348b5a61 -d '<json body>'
```

Example prompt: Analyze this genomic sequence query for supply chain traceability: 'ATCGGCTAGCTAGCTAGCATCGATCG' and give me a summary of what it tells us about the biological material's origin.

## When to prefer this

Use this endpoint when you need automated genomic sequence analysis specifically tied to supply chain verification workflows and can pay per-call in USDC via the x402 protocol on Base L2. Prefer this over generic bioinformatics APIs when you need a lightweight, monetized MCP-based integration without managing heavy genomic infrastructure.

## Known failure modes

- Missing required 'query' field returns validation error
- Malformed or non-genomic query string may yield inaccurate summary
- Payment failure via x402 protocol prevents execution
- Timeout if upstream MCP node is unavailable
- Boolean summary field provides minimal detail — no confidence score or detailed breakdown returned

## How this service works

The premier global index of 1,069 monetized MCP nodes across 205 specialized subdomains. Gasless USDC runtime settlements via x402 V2 Spec on Base L2. Save 95% token context.

## Output

Returns a JSON object with a 'summary' boolean field indicating the outcome of the genomic sequence analysis against the supply chain query context.

## Request schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "query"
 ],
 "properties": {
  "query": {
   "type": "string"
  }
 }
}
```

## Response schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "summary"
 ],
 "properties": {
  "summary": {
   "type": "boolean"
  }
 }
}
```

## More

- Live health (JSON, refreshed every minute): https://www.zero.xyz/c/supply-chain-genomic-sequence-analyzer-mcp-348b5a61/health.json
- [Zero catalog index](https://www.zero.xyz/llms.txt)
- [Other services from api.m2mcent.com](https://www.zero.xyz/host/api.m2mcent.com/llms.txt)