# Web3 Genomic Sequence Optimizer MCP Node

> Web3 Genomic Sequence Optimizer MCP Node is a paid API for AI agents from api.m2mcent.com, paid per call via x402, $0.621188/call, status unknown (last checked 2026-10-10).

Accepts a genomic sequence query string and returns a boolean result via a monetized MCP node on the M2MCent network

## Facts

- Endpoint: POST https://api.m2mcent.com/web3-genomic-sequence-optimizer-mcp-630/api/execute?utm_source=zero.xyz
- Price: $0.621188/call
- Payment: x402
- Status: unknown
- Last checked: 2026-10-10
- Activations on Zero: 0
- Tags: x402
- Canonical page: https://www.zero.xyz/c/web3-genomic-sequence-optimizer-mcp-node-4066c6b9
- Structured record (JSON): https://api.zero.xyz/v1/capabilities/cap_gch9bH_4uAeQFwq7EjE5d

Status and success rate cover calls made through Zero and Zero's own probes. Third-party monitors may report differently.

## How to call it through Zero

Zero handles the 402 payment challenge and records the run. With the Zero CLI installed (`npm i -g @zeroxyz/cli`):

```sh
zero fetch --capability web3-genomic-sequence-optimizer-mcp-node-4066c6b9 -d '<json body>'
```

Example prompt: Run the web3 genomic sequence optimizer on this DNA sequence: 'ATCGGCTATCGATCGTAGCTAGCTAGCTAGCT' and tell me if it passes optimization.

## When to prefer this

Choose this endpoint when you need a lightweight boolean decision on a genomic sequence string and want to leverage a decentralized, pay-per-call MCP node rather than a full bioinformatics API. Best suited for pipeline gating steps where a simple pass/fail is sufficient and on-chain micropayment settlement via USDC on Base L2 is acceptable.

## Known failure modes

- Missing or empty 'query' field returns a validation error
- Payment failure via x402 protocol results in a 402 Payment Required response
- Malformed query string may return false rather than an explicit error
- Network or node availability issues may cause timeouts or 5xx errors
- Ambiguous or non-genomic query strings may yield unreliable boolean results

## How this service works

The premier global index of 1,069 monetized MCP nodes across 205 specialized subdomains. Gasless USDC runtime settlements via x402 V2 Spec on Base L2. Save 95% token context.

## Output

A JSON object containing a single boolean field indicating whether the submitted genomic sequence query satisfies the optimizer's criteria (true = optimized/passes, false = does not pass).

## Request schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "query"
 ],
 "properties": {
  "query": {
   "type": "string"
  }
 }
}
```

## Response schema (JSON Schema)

```json
{
 "type": "object",
 "required": [
  "boolean"
 ],
 "properties": {
  "boolean": {
   "type": "boolean"
  }
 }
}
```

## More

- Live health (JSON, refreshed every minute): https://www.zero.xyz/c/web3-genomic-sequence-optimizer-mcp-node-4066c6b9/health.json
- [Zero catalog index](https://www.zero.xyz/llms.txt)
- [Other services from api.m2mcent.com](https://www.zero.xyz/host/api.m2mcent.com/llms.txt)